4 M ATERIALS AND METHODS
4.2 Methods
4.2.1 Immunohistochemistry (I, II III and IV)
For immunocytochemistry the cells were fixed in 100 % methanol 10 min in room temperature for smooth muscle actin staining and 4 % paraformaldehyde in 0,1 M phosphate buffer (PB) for other stainings for 60 min in room temperature and washed with PB. Tissue samples were fixed in buffered 4% paraformaldehyde or Histochoice®
(Amresco, Solon, OH), embedded in paraffin and cut into 5 µm sections. The sections were rehydrated and incubated in 1 % H2O2 to block the endogenous peroxidases, washed with water and blocked with 1 % BSA in (PB) at 37°C for 30 min.
For hyaluronan stainings the samples were incubated overnight at 4°C with biotinylated hyaluronan binding complex (bHABC), isolated from bovine articular cartilage and containing the biotinylated complex of link protein and G1 domain of aggrecan (Tammi et al. 1994). To control the specificity of the staining, hyaluronan was removed by preincubating the sections with Streptomyces hyaluronidase (Seikagaku, Kogyo, Tokyo, Japan).
For immunostainings the antibodies (Table 3) were diluted in 1 % BSA. The sections and cells were then washed in PB and incubated with biotinylated secondary antibodies diluted in 1:1000. After washing with PB, the sections were incubated with avidin–biotin peroxidase (Vector, 1:200) for 1 h. The color was developed with 0.05 % 3,3′-‐‑
diaminobenzidine (DAB; Sigma, St. Louis, MO) containing 0.03 % H2O2. The cells and tissue sections were then counterstained with Mayer’s hematoxylin for 1 min, washed, dehydrated, and mounted in DePex (BDH Laboratory Supplies, Poole, UK). The sections were photographed with Zeiss Axio Imager M2 light microscope (Carl Zeiss Microimaging GmbH, Jena, Germany).
Table 3. Used antibodies
Antibody dilution Company
HAS1 (sc-‐34021) 1:100 Santa Cruz Biotechnology, Santa Cruz, CA
HAS2 (sc-‐34067), 1:100 Santa Cruz Biotechnology, Santa Cruz, CA
HAS3 (sc-‐34204), 1:100 Santa Cruz Biotechnology, Santa Cruz, CA
CD44 1:100 Chemicon/Millipore, Billerica, MA
CD44 (Hermes 3) 1:100 A gift from Dr. Sirpa Jalkanen, Turku, Finland
Anti-‐CD44S (clone A020) 10 μg/ml Chemicon, Temecula, CA)
HBME-‐1 1:50 Dako, Carpinteria, CA
Villin 1:100 BD Biosciences, Bedford, MA
Ezrin 1:200 Thermo Scientific, Rockford, IL
Espin 1:10 A gift from Dr. Jim Bartles, Chicago, IL
Fascin 1:200 Dako, Glostrup, Denmark
Anti-‐β-‐tubulin 1:500 Roche Diagnostics GmbH, Mannheim, Germany
α-‐SMA (ab5694) 1:100 Abcam, Cambridge, MA
Caspase-‐3 (Asp175) 1:100 Cell Signaling technology, Danvers, MA
4.2.2 Transfections (I and IV)
Cell cultures grown on 8-‐‑well Ibidi chamber slides (Ibidi GmbH, Martinsried, Germany) were transfected with ExGen 500 transfection reagent (Fermentas, Helsinki, Finland). The constructs used were human Has3 cDNA in-‐‑frame with an N-‐‑terminal GFP fusion protein in the pCIneo vector (Rilla et al. 2012), HAS alone in the pCIneo vector (Törrönen et al.
2014), WT mCherry-‐‑Myo10, and Pleckstrin homology (PH) domain deleted Myo10 (Myo10 WT, Myo10ΔPH123, Myo10ΔPH2, and Myo10ΔPH2pm) as described (Plantard et al. 2010),
GFP-‐‑actin (Molecular Probes, Eugene, OR, USA) and Lifeact (pLifeact-‐‑TagRFP, Ibidi GmbH, Martinsried, Germany) (Riedl et al. 2008). The cells were examined 16–24 h after transfections with confocal imaging, either live for the GFP signal only, or after fixation with 4% (w/v) paraformaldehyde for 1 h at room temperature for both immunostainings and GFP.
4.2.3 Assays of hyaluronan (I, II, III and IV)
Cell cultures on 24-‐‑well plates were used to measure the secretion of hyaluronan. Cells were cultured for 24 h before counting the cells and harvesting the media for the sandwich type hyaluronan ELSA assay, as described (Hiltunen et al. 2002).
4.2.4 Isolation of microvesicles by ultracentrifugation (III and IV)
Microvesicles were isolated as described by (Kubikova et al. 2009). The growth medium was centrifuged at 100,000 x g for 1 h at 4 °C, the supernatant collected and sterile filtered with a 0.2 µμm filter (Minisart, Sartorius Stedim Biotech, Goettingen, Germany). Ten ml of the conditioned culture medium was centrifuged at 4000 x g for 20 min. The supernatant was collected and centrifuged at 100,000×g for 90 min. The pelleted microvesicles were washed with PBS and finally suspended into PBS or culture medium. For the staining of hyaluronan, the microvesicle suspension was incubated for 2 h at 37 °C with fluorescent HABC as described above, and imaged on a coverglass. The specificity of the staining was controlled by removing hyaluronan by preincubating the suspension with Streptomyces hyaluronidase (Seikagaku, Kogyo, Tokyo, Japan). To remove hyaluronan bound to receptors on plasma membrane, the suspension was treated with hyaluronan hexasaccharides (HA6, 0.2 mg/ml, kindly provided by Seikagaku). To measure the hyaluronan secreted on the microvesicles, the microvesicle suspension and its supernatant were subjected to ELSA as described above.
4.2.5 Flow cytometric analysis of microvesicles (IV)
Isolated microvesicles from MDCK cells stably overexpressing GFP (mock) and GFP-‐‑HAS3 were labeled with fluorescent HABC (Alexa Fluor®647) in culture media and analyzed with a BD FACSCanto II flow cytometer (Becton Dickinson, NJ, USA). Polysyterene beads of four different sizes, i.e. 0.25 µμm, 0.53 µμm, 0.79 µμm and 1.3 µμm (Catalog no. NPPS-‐‑4K, Spherotech, Lake Forest, IL 60045, USA) with a known concentration of 1×106 particles/ml were used to calibrate the flow cytometer and detect the microvesicles. Equal amounts of the beads were mixed with the microvesicle samples and 5000 events were recorded using 0.79 µμm beads as a reference. The microvesicles were gated between 0.25-‐‑-‐‑-‐‑0.79 µμm size range of the beads and, using 488 nm and 633 nm lasers, GFP and Alexa Fluor 647 fluorescences were measured from the analyzed microvesicles. Data processing was done with FCS4 Express (De NOVO, Los Angeles, CA, USA) and the results were expressed as a percentage of total population analyzed within the events.
4.2.6 Transmission electron microscopy (I, II and IV)
For ultrastructural analysis the tissue samples were cut into approximately 1x1x1 mm pieces. The pieces were immediately fixed with 2% paraformaldehyde and 0.5%
glutaraldehyde in PBS, pH 7.4, for 1 h. After fixation, the sections were washed with PBS at room temperature. The tissue blocks were stained for hyaluronan as described above. To control the specificity of the hyaluronan staining, hyaluronan was removed by preincubating the sections with Streptomyces hyaluronidase (Seikagaku) for 60 min and washed with PBS. The pieces were then postfixed with 1% osmium tetraoxide and contrasted with 1% uranyl acetate. For the analysis of microvesicles in MDCK cultures, 7-‐‑
day-‐‑old Matrigel™ cultures were prefixed with 2.5% glutaraldehyde in PB for 4 h at room
temperature. After an overnight wash in PBS and 1 h wash in water, the gels were postfixed in 1% osmium tetraoxide and 2.22% CaCl2 in H2O and stained with 1% uranyl acetate. The pieces were dehydrated and embedded in LX-‐‑112 resin (Ladd Research industries, Burlington, VT) and polymerized at 60°C for 48 h. The 70 nm sections were stained with 1
% uranyl acetate and imaged with an JEOL JEM-‐‑2100F electron microscope (Jeol, Tokyo, Japan) at 80 kV.
4.2.7 Scanning electron microscopy (II, III and IV)
For SEM, cells were grown on 13 mm coverslips. After 48 h, the cultures were washed and fixed with 2% paraformaldehyde and 0.5 % glutaraldehyde at room temperature and dehydrated through a graded series of ethanol. After critical point drying by using Emitech K850 Critical point drier (Quorum Technologies England), cells were shadowed with gold, and imaged with an XL30 TMP environmental SEM (FEI Company, The Netherlands) at 15 kV.
4.2.8 Confocal microscopy and FRAP analysis (I, II, III and IV)
For confocal microscopy, 20,000 cells per well were seeded in eight-‐‑well chamber slides (Ibidi GmbH, Martinsried, Germany). After two days incubation, hyaluronan was visualized using HABC (Tammi et al. 1994) coupled directly to fluorescent group(Rilla et al.
2008). The nuclei were stained with DRAQ5 (Biostatus Ltd., UK). The micrographs were obtained with a Zeiss LSM 700 confocal scanner on a Zeiss Axio Observer inverted microscope with a 63x oil objective.
4.2.9 Correlative light and electron microscopy (I)
In addition to the conventional confocal microscopy and SEM, correlative light and electron microscopy (CLEM) was utilized, as previously described (Rilla and Koistinen 2015). One day after transient transfection the cells were fixed with 2% (v/v) glutaraldehyde and fluorescent images were obtained with a Zeiss LSM 700 confocal module and an external DIC-‐‑capable transmitted-‐‑light channel. After routine processing for scanning electron microscopy, including dehydration and coating with gold, the cells were imaged with a Zeiss Sigma HD|VP (Zeiss, Oberkochen, Germany) at 3 kV.
4.2.10 Quantitative real-‐‑time PCR (qRT-‐‑PCR) (II and III)
The mRNA levels of Has1-‐‑3 were measured using quantitative real-‐‑time PCR (qRT-‐‑PCR).
Primary mesothelial cells were seeded on 6-‐‑well plates at 500,000 cells/well. The cells were allowed to grow nearly 100 % confluent. The RNA was extracted with TRI Reagent©
(Molecular Research Center Inc., Cinnati, OH) according to protocol provided by the manufacturer. For the isolation of RNA from intact rat mesothelium, parietal peritoneum from freshly killed rats was opened. The peritoneal lining was gently scraped with a scalpel and the material suspended into TRI Reagent©. RNA extraction proceeded as instructed.
The cDNAs were synthesized using the Verso cDNA kit (Thermo Scientific) and the qRT-‐‑PCR was performed with Fast Start Universal SYBR Green mix (Roche Applied Science) using a Stratagene Mx300P real-‐‑time PCR system (Agilent Technologies). The HAS1-‐‑3 primers used were designed so that they recognize both rat and human Has1-‐‑3 mRNA. The primer sequences used are shown in Table 1. Has1-‐‑3 copy numbers were calculated by using serial dilutions of dendra-‐‑HAS1-‐‑3 plasmids (Bart et al. 2015) as a standard curve. The main impurity source in mesothelial cell samples is the underlying striated muscle layer. In order to check the sample purity, the cDNA samples were analyzed for mesothelium specific (MSLN, NM 031658.1)(Kanamori-‐‑Katayama et al. 2011;
Uhlen et al. 2010) and muscle specific (TNNI2, NM 017185.1 and NEB, XM 229925.4) (Joo et al. 2004; Liu et al. 2008; Mullen and Barton 2000; Pappas et al. 2011; Stefancsik et al. 2003;
Uhlen et al. 2010) mRNA (their primers in Table 4). The PCR products of MSLN; TNNI2 and NEB were run in an agarose gel and visualized with ethidium bromide. In the IV study, control, Has1-‐‑3 mRNA levels of EGF and wound treatments were compared and the ribosomal protein LPO was used as a reference gene.
Table 4. The primers used in the amplification of cDNA.
Gene Primer sequences Product size
Hyaluronan synthase 1 HAS1 Forward 5’ ACTACGTGCAGGTCTGTGACTC
179 bp Reverse 5’ ATTGAAGGCTACCCAGTATCG
Hyaluronan synthase 2 HAS2 Forward 5’ GTTGCATGAGTTTGTGGAAGA
210 bp Reverse 5’ TCTCGGAAGTAGGACTTGCTC
Hyaluronan synthase 3 HAS3 Forward 5’ CCTCACAGAGACCCCCACTA
111 bp Reverse 5’ TGGTGCTTATGGAACCACAG
Mesothelin MSLN Forward 5’ TATCTTCGGGGAGGAGGCAA
135 bp Reverse 5’ GAGCCCAACCAGCCACATAA
Troponin I, type 2 TNNI2 Forward 5’ AGCAAGGAGCTGGAAGACAT
242 bp Reverse 5’ CCATGCCAGACTTCTCCTCA
Nebulin NEB Forward 5’ ACTGTCTTCCATCCCGTCAC
151 bp Reverse 5’ GCCATACATCCAGCCTTCAT
Cluster of differentiation 44 CD44 Forward 5’ TAGCCCTGAGAAAGGGGTTT
100 bp Reverse 5’ TTGTTGGCTGCACAGATAGC
E-Cadherin CAD Forward 5’ GCAGGATTACAAGTTCCCGC
138 bp Reverse 5’ GGTATCGTCATCTGGTGGCA
αα Smooth muscle actin ααSMA Forward 5’ ATCCGACCTTGCTAACGGAG
151 bp Reverse 5’ GAAGGAATAGCCACGCTCAG
4.2.11 EGF and wounding experiments (III)
The primary cells were seeded and grown to 100% confluency, the growth media was changed to DME/F12 (1:1) with 2% FBS (PAA Laboratories), Penicillin-‐‑G 100 U/ml (Sigma), Streptomycin 100 U/ml (Sigma) and cells were incubated for 72 h. After incubation, the medium containing 20 % FBS was changed, and followed with either a 24 h incubation or EGF (Sigma, 10 ng/ml) was added to the media containing 20% or 2 % FBS, followed by 24 h incubation. Some of the confluent cell cultures were wounded with a pipette tip followed by a wash with HBSS and a 16 h incubation in a growth medium containing 2% or 20 % FBS.
4.2.12 Nanoparticle tracking analysis (III)
The quantitative analysis of extracellular vesicles secreted by primary mesothelial cells was performed using Nanoparticle Tracking Analyzer (Malvern Instruments Ltd, Malvern, UK) with a NS300 view unit. The culture media collected from mesothelial cells were centrifuged at 1000xg for 10 min to remove cell debris, followed by pelleting of
“microvesicles” at 20,000xg for 90 min. The pellets were then suspended in PBS and diluted 1:10 or 1:20 in PBS before the analysis. The data acquisition was achieved with the following settings; camera level 13, acquisition time 40 s, and threshold 3. Triplicate measurements were performed for each sample and the data analysis was performed with NTA 3.1 software (NanoSight, Amesbury, UK).
4.2.13 Statistical analysis (III)
Univariate analysis of variance was used to test the significances of the differences between the groups in hyaluronan assays and mRNA expression levels. The tests were performed using GraphPad Prism version 5.00 for Windows, (GraphPad Software, San Diego, CA USA). The differences were considered significant as follows: *** = p<0.001, ** = p<0.01, * = p<0.05.