UEF//eRepository
DSpace https://erepo.uef.fi
Rinnakkaistallenteet Luonnontieteiden ja metsätieteiden tiedekunta
2019
Recombinase Polymerase
Amplification Assay for fast, sensitive and on-site detection of Phytophthora cactorum without DNA extraction
Munawar, M
Tieteelliset aikakauslehtiartikkelit
© ISHS
All rights reserved
http://dx.doi.org/10.17660/eJHS.2019/84.1.2
https://erepo.uef.fi/handle/123456789/7500
Downloaded from University of Eastern Finland's eRepository
14 E u r o p e a n J o u r n a l o f H o r t i c u l t u r a l S c i e n c e
Introduction
Phytophthora cactorum has a broad host range compris- ing more than 154 genera of vascular plants and exhibits genetic variation depending on host and geographic location (Phytophthora Database, 2006). P. cactorum is one of the primary causative agents of the soil-borne disease of straw- berry crown rot all over the world. It infects the crown and causes necrosis and death of infected plants (Maas, 1998;
Eikemo et al., 2004). European and Mediterranean Plant Pro- tection Organization (OEPP/EPPO, 1994) allows up to 1%
presence of crown rot disease in certified plant production fields (Stensvand et al., 1999). This pathogen can also cause symptomless latent infections of strawberry plants, leading to transport of infected propagation material across Europe and contributing to the spread of disease (Harris and Stick- els, 1981; Santos et al., 2002).
In Europe, strawberry crown rot was first reported in Germany during 1952 (Deutschmann, 1954). Since about 1960, the disease has significantly damaged the strawber- ry crop in Europe (Maas, 1998). In Northern Europe, crown rot was first detected in Sweden in 1988 (Stensvand et al., 1999). In Finland, P. cactorum was first isolated in 1990 from crown rot of an infected strawberry plant (Parikka, 1991).
We have noticed up to 50% loss in fields of Eastern Finland in summer 2016. In Norway, crown rot was first detected in 1992 (Stensvand and Semb, 1995). A survey in 1999 re- ported presence of crown rot in several strawberry culti- vating regions of Norway despite the country strictly bans
import of strawberry plants since 1986 (Stensvand et al., 1999). Regarding Southern Europe, a study found five fields having crown rot between 2000 and 2001 in Huelva city of Spain (Santos et al., 2002). Beside Europe, strawberry crown rot has also been reported in the USA, Japan, South Africa, Australia and New Zealand (Eikemo et al., 2004). In eastern North America, crown rot was reported for the first time in 1988 (Wilcox, 1989). Similarly, P. cactorum is considered as the most common agent of strawberry crown rot in Flori- da, United States (Marin et al., 2018). In Japan, outbreaks of strawberry crown rot in 1978 were caused by Phytophthora nicotianae and P. cactorum (Li et al., 2013).
Several methods have been developed for detection of Phytophthora, including microscopy, baiting, immunological assays and polymerase chain reaction (PCR) (Martin et al., 2012). Microscopic identification of Phytophthora on species
Recombinase Polymerase Amplification Assay for fast, sensitive and on-site detection of Phytophthora cactorum without DNA extraction
M. Munawar
1, A. Toljamo
1, F. Martin
2and H. Kokko
11 Department of Environmental and Biological Sciences, University of Eastern Finland, Kuopio, Finland
2 United States Department of Agriculture, ARS, Salinas, USA
Original article – Thematic Issue
German Society for Horticultural Science
Significance of this study
What is already known on this subject?
• Crown rot caused by Phytophthora cactorum has been damaging strawberry crops in Europe for more than half a century. For the detection of P. cactorum, the current recommended technique is Polymerase Chain Reaction (PCR). TaqMan PCR assays based on ras-related protein gene Ypt1, and atp9-nad9 marker have been developed for P. cactorum. PCR is a time- consuming method requiring DNA extraction, and is not suitable for on-site testing.
What are the new findings?
• Using the Recombinase Polymerase Amplification (RPA) technology, we have developed an ultra- sensitive, specific, and on-site assay for detection of P. cactorum and diagnosis of crown rot. The assay enables detection of P. cactorum directly from crudely macerated crown tissue and eliminates the need of time-consuming DNA extraction.
What is the expected impact on horticulture?
• For nurseries, the assay will assist production and maintenance of healthy plant stocks, and may serve as a certificate of P. cactorum absence in plant material being sold.
• For farmers, the assay can serve as pre-screen of propagation material before planting into fields.
• For diagnostic laboratories, the assay will accelerate the diagnosis process for the pathogen.
Summary
Crown rot, caused by Phytophthora cactorum, is an increasing problem for the strawberry crop in Europe. Most of the assays available for the detection P. cactorum are either laborious or inadequate for on- site testing. Recombinase Polymerase Amplification (RPA) is an attractive alternative for rapid detection of pathogens from plant material. We have developed an RPA assay for P. cactorum using the intergenic mi- tochondrial DNA spacer between atp9 and nad9. The assay is specific, and sensitive with a lower limit of de- tection with purified DNA of 10 fg. Moreover, the assay is DNA extraction-free, and requires only two minutes of tissue maceration prior to running the RPA assay.
Keywords
atp9, crown rot, crude maceration, Phytophthora isolation, nad9, strawberry
Munawar et al. | Rapid detection of strawberry crown rot
level is complicated. Some Phytophthora species have over- lapping morphological characteristics, while other species exhibit intraspecific morphological variations (Erwin and Ri- beiro, 1996). The bait tests are time-consuming and require up to five weeks for certain Phytophthora species (Bonants et al., 1997). Moreover, the immunological assays like en- zyme-linked immunoassay (ELISA) lack specificity. The com- monly available genus specific ELISAs for Phytophthora de- tection have been reported to cross react with some Pythium spp. (Bulluck et al., 2006; Kox et al., 2007). Similarly, the few Phytophthora species level ELISAs developed also encoun- tered false positivity with the non-target Phytophthora spe- cies (Avila et al., 2009). The PCR, especially TaqMan real time PCR, is considered as a gold standard in diagnostics, however a few of the PCR assays developed for identification of Phy- tophthora species have also been reported to cross react with non-target Phytophthora species (Hughes et al., 2006; Bilo- deau et al., 2007; Schena et al., 2008; Martin et al., 2009). The cross reactivity probably resulted due to the level of inter- specific variability present in loci targeted by these assays.
TaqMan PCR assays have been developed specifically for P. cactorum detection. Li et al. (2013) developed TaqMan assay using single copy gene, ras-related protein gene Ypt1 and recorded detection limit as 1 pg. Recently a suitable, multicopy and non-cross reacting intergenic DNA marker, the mitochondrial spacer between atp9 and nad9, has been reported for Phytophthora detection and identification at a species level. Through atp9-nad9, TaqMan PCR assays have been developed for 13 Phytophthora species, including P. cac- torum. The lower limit of detection of those TaqMan assays were reported around 100 fg (Bilodeau et al., 2014; Miles et al., 2017).
Although PCR is adequately sensitive and specific for Phytophthora detection, it is not suitable for on-site testing due to the need for DNA extraction and use of a thermocycler.
Moreover, PCR also can be inhibited by some substances ex- tracted along the plant nucleic acid (Schrader et al., 2012). To address these problems, isothermal assays like Recombinase Polymerase Amplification (RPA) are promising alternatives.
RPA is a rapid, sensitive and specific method of isothermal nucleic acid amplification. RPA utilizes longer primers, re- combinase enzyme, single-stranded DNA binding (SSB) pro- tein and strand displacing polymerase enzyme for amplify- ing nucleic acid (Piepenburg et al., 2006). RPA is also more tolerant to inhibitors and from a crude maceration of the plant tissue the target nucleic acid can be amplified (Mekuria et al., 2014; Miles et al., 2015).
RPA assays for few Phytophthora species have been de- veloped targeting the mitochondrial spacer between atp9 and nad9 (Miles et al., 2015; Rojas et al., 2017). In these as- says, the forward primer and the common probe was placed in the genus-conserved region of atp9, while the reverse primer was in the intergenic spacer atp9-nad9. Following the TwistDx Inc., UK recommendations, a different design for the assay was adopted in this study. Only the forward primer was positioned in the genus-conserved region of atp9, while the reverse primer and the overlapping probe were placed the intergenic spacer atp9-nad9. Selecting both the probe and reverse primer from the intergenic region may increase the assay specificity, and also reduce template length, hence shortening time of the assay. This kind of strategy may also prove useful for design of assays for additional Phytophthora species for multiplexing. So, this study aims to develop RPA assay for detection of P. cactorum and presents a different
approach to design atp9-nad9 based species level assays for Phytophthora detection.
Materials and methods
Phytophthora isolation
Strawberry plants of different cultivars from fields and imported plant trade were collected from Finland. Then crowns were dissected vertically, and crown tissue pieces were surfaced sterilized by single dip in 70% ethanol. Then crown pieces were left for drying on filter paper for two to three hours. Later the pieces were placed on Phytophthora selective agar plates and plates were incubated on room tem- perature and inspected every 48 h for possible Phytophthora growth. The Phytophthora selective agar was composed of corn meal agar supplemented with 250 mg L-1 ampicillin, 25 mg L-1 benomyl, 10 mg L-1 pimaricin, 10 mg L-1 rifampicin and 50 mg L-1 hymexazol as described byDrenth and Sendall (2001). Corn meal agar (product no. 42347), ampicillin and benomyl were purchased from Sigma-Aldrich, pimaricin (na- tamycin) from Molekula, Germany, rifampicin from Duchefa Biochemie Netherlands, and hymexazol from Alfa Aesar.
DNA extraction and sequencing
P. cactorum isolates originated from strawberry fields, ten were isolated from the Savo region of Finland and fifteen were from Poland. The agar plugs containing hyphae were added to petri dishes filled with peptone glucose broth at room temperature. After 7–10 days growth, the hyphae were separated from the agar plug and washed three times with sterile water. The hyphae were lyophilized overnight and then powdered by small plastic pestle in a round bottom 2-mL Eppendorf tube. DNA was extracted from up to 50 mg freeze-dry hyphae or up to 200 mg wet hyphae using E.Z.N.A.
Fungal DNA Mini Kit from Omega Bio-tek, Georgia, US.
The atp9-nad9 regions were amplified and Sanger se- quenced from all isolates as per previously described (Mar- tin and Coffey, 2012; Bilodeau et al., 2014) except the PCR master mix which was differing. The annealing tempera- ture was re-optimized as 57°C for the DreamTaq Green PCR Master Mix (2X) from ThermoScientific. Amplification PCRs were run on Bio-Rad thermocycler PTC-100, while Sanger sequencing reactions were completed at GATC Biotech, Ger- many.
Assay design and optimization
The atp9-nad9 sequences of several Phytopthora species were obtained from supplementary FASTA file of Miles et al.
(2015). All the sequences were aligned by Geneious 8.1.8.
The intergenic and conserved regions of atp9-nad9 regions were identified, and then primers and probe were picked manually for P. cactorum. The reverse primer is overlapping with the probe in the same direction while the overlap is extended up to the fluorophore position of the probe. The primers and probe orientations are explicitly presented in Figure 1.
TwistAmp® exo lyophilised kits were purchased from TwistDx Inc., UK, and primers and probe were designed as per manufacturer instructions. TwistAmp exo probe, puri- fied with dual HPLC was ordered from LGC Biosearch Tech- nologies, US, while five forward and five reverse primers were ordered as standard desalted form through LGC Bio- search Technologies, US, and Integrated DNA Technologies, Belgium. Following the instructions of TwistDx Inc., prim-
16 E u r o p e a n J o u r n a l o f H o r t i c u l t u r a l S c i e n c e ers were first screened to choose the optimum primer pair.
The concentration ratio of the optimum forward and reverse primers were adjusted to obtain maximum sensitivity. All the
TwistAmp® exo reaction components except primers were kept at recommended optimal concentrations. The reactions were incubated at 39°C for 20 min with a manual agitation at 4 min, while the real time fluorescence was monitored through T8-ISO, Axxin or Mx3000P QPCR System, Agilent.
Sensitivity and specificity of assay
The cross reactivity of the assay was tested against the available Phytopthora, Pythium and fungal species. To eval- uate the lower limit of detection and linearity of the assay, 1 ng µL-1 P. cactorum DNA was prepared from Qubit 2.0 Flu- orometer quantified DNA and serially diluted 1/10 down to 1 fg µL-1. A standard curve between onset of amplifications and log of DNA concentrations of the dilutions was drawn.
The onset of amplification were recorded in minutes while the first four minutes of incubation and the one minute of agitation were excluded.
Crude maceration
Crown tissues of strawberry plants were macerated with a standard ELISA grinding buffer (Miles et al., 2015) in round bottom 2-mL Eppendorf tubes with plastic pestles. To opti- mize crude maceration, four different proportions of grind- ing buffers were tested. The four maceration included 1:5, 1:10, 1:15 and 1:20 crown mass/buffer ratio. For instance, to prepare 1:5 maceration with 51 mg crown tissue, 255 µL of buffer was added. Similarly for 76 mg tissue, 1:15 macer- ate was prepared by supplementing total 1140 µL buffer. To facilitate maceration, initially only 100 µL of buffer was add- ed and after maceration with pestles, additional buffer was supplemented. The macerates were left for settling of partic- ulates for few minutes and 1 µL volume of supernatants were later transferred to RPA reactions.
In the comparison of four different proportions of buffer, symptomless or early symptom crown tissue, and symptom- atic crown tissue with brownish spot were utilized. The early symptoms included light brown or water soak appearance of crown, while dark brown spots on crown were considered as late symptoms (Maas, 1998). In symptomless or early symp- toms plants, crown pieces were collected along the cross section, while in the plants with rot, crown pieces contain- ing both healthy and rotten portions were collected. Both the late symptoms and early symptoms plants were pre-con- firmed for presence of P. cactorum through DNA extraction
9
FIGURE 1. The forward primer is located at one end of the genus conserved atp9 gene, while the reverse primer and the overlapping reverse probe are in the intergenic spacer between atp9 and nad9. The figure only represents location of the primers and probe, and not reflect the length of the amplicon and the spacer.
Figure 1. The forward primer is located at one end of the genus conserved atp9 gene, while the reverse primer and the overlapping reverse probe are in the intergenic spacer between atp9 and nad9. The figure only represents location of the primers and probe, and does not reflect the length of the amplicon and the spacer.
10
FIGURE 2. On the left, the crown shows early symptom of crown rot. A discoloration spot in the top part of the crown is prominent. On the right, the crown shows late symptoms of crown rot. Both strawberry plants werecollected from fields of Pohjois-Savo, Finland.
Figure 2. On top, the crown shows early symptoms of crown rot. A discoloration spot in the top part of the crown is prominent. Below, the crown shows late symptoms of crown rot. Both strawberry plants were collected from fields of Pohjois-Savo, Finland.
V o l u m e 8 4 | I s s u e 1 | F e b r u a r y 2 0 1 9 17 Munawar et al. | Rapid detection of strawberry crown rot
(DNeasy Plant Mini kit, Qiagen) and Sanger sequencing of the atp-nad9 locus as mentioned earlier. Figure 2 shows early and late symptoms of crown rot.
To determine if crown tissue will inhibit RPA, healthy crown tissue (also negative through the RPA assay) was mac- erated to prepare 1:5, 1:10, 1:15 and 1:20 crown mass/buf- fer ratio macerates. Then RPA reactions supplemented with 1 pg, 100 fg and 10 fg DNA of P. cactorum were separately spiked with 1 µL of 1:5, 1:10, 1:15 and 1:20 macerates. The DNA concentrations of 1 pg, 100 fg and 10 fg without spiking with the crown tissue macerates were included as controls.
No template controls (NTC) were also included, while all RPA reaction were performed in duplicates.
Results
Isolation and sequencing
Isolation was always successful when discoloured dark brown pieces from typical crown rot were well-dried before plating on the agar plates. We observed that drying crown tissues for few hours or overnight and using moisture free selective agar plates ensure isolation of Phytophthora cacto- rum from crown rot. Isolation from symptomless or latently infected crown rot was rarely successful.
The P. cactorum isolates recovered from strawberry fields exhibited minimal sequence variation for the atp9- nad9 marker. All ten Finnish and twelve of the fifteen Polish P. cactorum isolates were 100% identical. Among those iden- tical, atp9-nad9 sequence of one isolate, KRJ1 was submitted to NCBI (GenBank accession no. MH094138). The three dif- fering Polish isolates included PO264 (GenBank accession no. MH094139), PO266 (GenBank accession no. MH094140)
and PO267. The isolate PO267 was 100% identical to PO266 for atp9-nad9 region. The SNPs found in the three Polish iso- lates were not located in the primers/probe binding sites.
Optimum assay
The optimum concentration of forward primer, ‘Phy_
Gen_F3’ was 260 nM (1.3 µL of 10 µM), while the optimum concentration for reverse primer, ‘Phy_Cac_R1’ was 600 nM (3 µL of 10 µM). The other components were added as per recommendation of the manufacturer; the probe ‘Phy_Cac_
RevP2’ at 120 nM (0.6 µL of 10 µM), rehydration buffer as 29.5 µL, water as 12.1 µL, template (DNA or macerate) as 1 µL and MgOAc as 2.5 µL. The sequences of the optimum primers and the probe are given in Table 1.
The lower limit of detection of purified DNA in the opti- mum assay was recorded as 10 fg and the standard curve be- tween onset of amplifications and log of DNA concentrations produced an R2 value of 0.9923. The amplification curves for P. cactorum DNA serial dilutions ranging from 1 ng to 10 fg are presented in Figure 3. In specificity testing, the assay did not cross react with Phytophthora fragariae, Phytophthora megasperma, Phytophthora rosacearum, Phytophthora taxon raspberry, Phytophthora ramorum, Phytophthora plurivora, Phytophthora pini, Phytophthora cambivora, Pythium sylvati- cum, Colletotrichum acutatum, Botrytis cinerea, and Fusarium avenaceum.
Crude maceration
Crowns with late symptoms of crown rot showed posi- tive RPA with all proportions of buffer that were used in the maceration. However, crowns with low levels of infection, displaying early symptoms or symptomless, required 1:20 Table 1. Sequences of the optimal primers and the TwistAmp exo probe.
Primer/probe Name Sequence (5’ to 3’)
Forward primer Phy_Gen_F3 TGATGGCTTTCTTAATTTTATTTGCTTTTTA Reverse primer Phy_Cac_R1 TAAATTATTTTTATAAATAGTGTTAATAAT
Probe (TwistAmp exo probe) Phy_Cac_RevP2 TAAATTATTTTTATAAATAGTGTTAATAA-T(FAM)-(dSpacer)-A-T(BHQ1)- ATAACATGTAAAA(C3-Spacer)
FIGURE 3. Amplification curves of the serial dilutions of purified Phytophthora cactorum total DNA ranging from 1 ng to 10 fg. The NTC stands for no template control.
0 5000 10000 15000 20000 25000 30000 35000 40000 45000 50000
1 5 9 13 17 21 25 29
Fluor escenc
eTime in minutes
1 ng 100 pg 10 pg 1 pg 100 fg 10 fg NTC
Figure 3. Amplification curves of the serial dilutions of purified Phytophthora cactorum total DNA ranging from 1 ng to 10 fg.
The NTC stands for no template control.
18 E u r o p e a n J o u r n a l o f H o r t i c u l t u r a l S c i e n c e maceration to show a positive detection. Spiking the purified
DNA with plant macerate at the levels tested did not inhibit RPA.
Discussion
RPA requires minimal laboratory equipment and the as- say can be performed in fields and nurseries with portable fluorometers. Its lower limit of detection and specificity is comparable to gold standard molecular assays like TaqMan real time PCR. RPA is also rapid and eliminates the need for time-consuming and problematic DNA extraction from plants. The cost of maceration buffer and pestles is also min- imal.
The specificity of the assay was tested against the Phy- tophthora species available in our collection and found to not have background amplification. We compared the targeted atp9-nad9 spacer of P. cactorum with the 267 sequences of non-P. cactorum species provided by Miles et al. (2015), the closest sequences were of Phytophthora pseudotsugae, Phy- tophthora hedraiandra, and Phytophthora idaei. However, none of these species are considered strawberry pathogens and therefore no false positives are expected when sampling field plants. Trials with DNA from a variety of taxa is in prog- ress to more completely evaluate specificity.
Although we focussed on the P. cactorum isolates origi- nated from strawberry plants for the development of our as- say, but the assay is equally applicable for detection of P. cac- torum isolates from other plant sources. The isolates from strawberry and non-strawberry sources have a few SNPs difference in the intergenic spacer atp9-nad9 and those SNPs are mostly not present in the primer/probe binding sites.
Regarding preceding RPA assays developed for Phy- tophthora species using the atp9-nad9 maker, Miles (2015) reported a lower limit of detection of 200 fg while Rojas et al. (2017) reported 10 pg as the consistent detection level of the assay. These limits of detection may be due to the low concentration of the forward primer utilized as a tactic to improve specificity. The major difference of our RPA assay with these assays was the location of the probe, although the amplicon size was also shorter in our RPA assay. From the design of our RPA assay the overlap between a primer and a probe extended to the fluorophore position of the probe, confirming this approach can be effective for assay design.
Being a sensitive technique, RPA requires a special care to avoid possible carryover contamination. The reagent car- ryover can be controlled by using filter tips for pipetting RPA reagents, while the random carryover should be overcome by running RPA reactions in duplicates. All the RPA batches should also include a negative control or NTC to timely detect carryover contamination.
Our next plans include field validation of our RPA assay.
Up to this point we have found RPA as a suitable method for P. cactorum detection from strawberry plants. We believe that the future availability of the ready-to-use kits with prim- ers and probe included in lyophilized pellets will simplify the assay and enable farmers to test plant material themselves.
Acknowledgments
We thank Arja Lilja (Natural Resources Institute Fin- land), Monika Michalecka (Research Institute of Horticulture in Skierniewice) and Grażyna Szkuta (Państwowa Inspekcja Ochrony Roślin i Nasiennictwa) for Phytophthora isolates.
References
Avila, F.J., Schoedel, B., Abad, Z.G., Coffey, M.D., and Blomquist, C.
(2009). ELISA and ImmunoStrip® for detection of Phytophthora ramorum, P. kernoviae, and other Phytophthora species. Proceedings of the Sudden Oak Death Fourth Science Symposium. https://
www.fs.fed.us/psw/publications/documents/psw_gtr229/psw_
gtr229_095.pdf (accessed October 28, 2017).
Bilodeau, G.J., Martin, F.N., Coffey, M.D., and Blomquist, C.L. (2014).
Development of a multiplex assay for genus-and species-specific detection of Phytophthora based on differences in mitochondrial gene order. Phytopathology 104(7), 733–748. https://doi.
org/10.1094/PHYTO-09-13-0263-R.
Bilodeau, G.J., Lévesque, C.A., De Cock, A.W.A.M., Duchaine, C., Brière, S., Uribe, P., Martin, F.N., and Hamelin, R.C. (2007). Molecular detection of Phytophthora ramorum by real-time polymerase chain reaction using TaqMan, SYBR Green, and molecular beacons. Phytopathology 97(5), 632–642. https://doi.org/10.1094/PHYTO-97-5-0632.
Bonants, P., Hagenaar-de Weerdt, M., Van Gent-Pelzer, M., Lacourt, I., Cooke, D., and Duncan, J. (1997). Detection and identification of Phytophthora fragariae Hickman by the polymerase chain reaction. Europ. J. Plant Pathol. 103(4), 345–355. https://doi.
org/10.1023/A:1008640227432.
Bulluck, R., Shiel, P., Berger, P., Kaplan, D., Parra, G., Li, W., Levy, L., Keller, J., Reddy, M., Sharma, N., and Dennis, M. (2006). A comparative analysis of detection techniques used in US regulatory programs to determine presence of Phytophthora ramorum in Camellia japonica
‘Nucio’s Gem’ in an infested nursery in Southern California. Plant Health Progress. https://doi.org/10.1094/PHP-2006-1016-01-RS.
Deutschmann, F. (1954). Eine Wurzelfäule an Erdbeeren, hervorgerufen durch Phytophthora cactorum (Leb. et Cohn) Schroet.
Nachrichtenblatt des Deutschen Pflanzenschutzdienstes 6, 7–9.
Drenth, A., and Sendall, B. (2001). Practical guide to detection and identification of Phytophthora. CRC for Tropical Plant Protection, Brisbane, Australia, p. 1–41.
Eikemo, H., Klemsdal, S.S., Riisberg, I., Bonants, P., Stensvand, A., and Tronsmo, A.M. (2004). Genetic variation between Phytophthora cactorum isolates differing in their ability to cause crown rot in strawberry. Mycol. Res. 108(3), 317–324. https://doi.org/10.1017/
S0953756204009244,
Erwin, D.C., and Ribeiro, O.K. (1996). Phytophthora Diseases Worldwide. American Phytopathological Society, St. Paul, MN.
Harris, D.C., and Stickels, J.E. (1981). Crown rot (Phytophthora cactorum) in glasshouse-grown strawberries at East Malling Research Station. Plant Pathol. 30(4), 205–212. https://doi.
org/10.1111/j.1365-3059.1981.tb01258.x.
Hughes, K.J., Tomlinson, J.A., Griffin, R.L., Boonham, N., Inman, A.J., and Lane, C.R. (2006). Development of a one-step real-time polymerase chain reaction assay for diagnosis of Phytophthora ramorum.
Phytopathology 96(9), 975–981. https://doi.org/10.1094/
PHYTO-96-0975.
Kox, L.F.F., Brouwershaven, I.V., Vossenberg, B.V.D., Beld, H.V.D., Bonants, P.J.M., and Gruyter, J.D. (2007). Diagnostic values and utility of immunological, morphological, and molecular methods for in planta detection of Phytophthora ramorum. Phytopathology 97(9), 1119–1129. https://doi.org/10.1094/PHYTO-97-9-1119.
Li, M., Inada, M., Watanabe, H., Suga, H., and Kageyama, K. (2013).
Simultaneous detection and quantification of Phytophthora nicotianae and P. cactorum, and distribution analyses in strawberry greenhouses by duplex real-time PCR. Microbes and Environm.
28(2), 195–203. https://doi.org/10.1264/jsme2.ME12177.
Maas, J.L. (1998). Compendium of Strawberry Diseases (ed. 2).
American Phytopathological Society (APS Press).
Munawar et al. | Rapid detection of strawberry crown rot
Marin, M.V., Seijo, T.E., Oliveira, M.S., Zuchelli, E., Mertely, J., and Peres, N.A. (2018). First report of Phytophthora nicotianae causing crown rot of strawberry in the United States. Plant Disease 102(7), 1463. https://doi.org/10.1094/PDIS-08-17-1333-PDN.
Martin, F.N., Coffey, M.D., Zeller, K., Hamelin, R.C., Tooley, P., Garbelotto, M., Hughes, K.J.D., Kubisiak, T., Bilodeau, G.J., Levy, L., and Blomquist, C. (2009). Evaluation of molecular markers for Phytophthora ramorum detection and identification: testing for specificity using a standardized library of isolates. Phytopathology 99(4), 390–403.
https://doi.org/10.1094/PHYTO-99-4-0390.
Martin, F.N., Abad, Z.G., Balci, Y., and Ivors, K. (2012). Identification and detection of Phytophthora: reviewing our progress, identifying our needs. Plant Disease 96(8), 1080–1103. https://doi.
org/10.1094/PDIS-12-11-1036-FE.
Martin, F.N., and Coffey, M.D. (2012). Mitochondrial haplotype analysis for differentiation of isolates of Phytophthora cinnamomi.
Phytopathology 102(2), 229–239. https://doi.org/10.1094/
PHYTO-04-11-0115.
Mekuria, T.A., Zhang, S., and Eastwell, K.C. (2014). Rapid and sensitive detection of Little cherry virus 2 using isothermal reverse transcription-recombinase polymerase amplification. J. Virolog.
Meth. 205, 24–30. https://doi.org/10.1016/j.jviromet.2014.04.015.
Miles, T.D., Martin, F.N., and Coffey, M.D. (2015). Development of Rapid Isothermal Amplification Assays for detection of Phytophthora spp. in plant tissue. Phytopathology 105(2), 265–278. https://doi.
org/10.1094/PHYTO-05-14-0134-R.
Miles, T.D., Martin, F.N., Robideau, G.P., Bilodeau, G.J., and Coffey, M.D.
(2017). Systematic development of Phytophthora species-specific mitochondrial diagnostic markers for economically important members of the genus. Plant Disease 101(7), 1162–1170. https://
doi.org/10.1094/PDIS-09-16-1224-RE.
Parikka, P. (1991). Phytophthora cactorum on strawberry in Finland.
Nordisk Jordbruksforskning 73, 121.
Phytophthora Database. Phytophthora cactorum. (2006). http://
www.phytophthoradb.org/species.php?a=dv&id=51237&p=
1&l=200&sv=&sf=&opt=0 (accessed October 28, 2017).
Piepenburg, O., Williams, C.H., Stemple, D.L., and Armes, N.A. (2006).
DNA detection using recombination proteins. PLoS Biology 4(7), e204. https://doi.org/10.1371/journal.pbio.0040204.
Rojas, J.A., Miles, T.D., Coffey, M.D., Martin, F.N., and Chilvers, M.I.
(2017). Development and application of qPCR and RPA genus-and species-specific detection of Phytophthora sojae and P. sansomeana root rot pathogens of soybean. Plant Disease 101(7), 1171–1181.
Santos, B.D.L., Porras, M., Blanco, C., Barrau, C., and Romero, F.
(2002). First report of Phytophthora cactorum on strawberry plants in Spain. Plant Disease 86(9), 1051–1051. https://doi.org/10.1094/
PDIS.2002.86.9.1051A.
Schena, L., Duncan, J.M., and Cooke, D.E.L. (2008). Development and application of a PCR-based ‘molecular tool box’ for the identification of Phytophthora species damaging forests and natural ecosystems.
Plant Pathology 57(1), 64–75.
Schrader, C., Schielke, A., Ellerbroek, L., and Johne, R. (2012).
PCR inhibitors–occurrence, properties and removal. J. Appl.
Microbiol. 113(5), 1014–1026. https://doi.org/10.1111/j.1365- 2672.2012.05384.x.
Stensvand, A., and Semb, L. (1995). Rotstokkròte – ein ny jordbærsjukdom (Crown rot – a new strawberry disease).
Gartneryrket 85(6), 23–25.
Stensvand, A., Herrero, M.L., and Talgø, V. (1999). Crown rot caused by Phytophthora cactorum in Norwegian strawberry production. EPPO Bull. 29(1–2), 155–158. https://doi.org/10.1111/j.1365-2338.1999.
tb00809.x.
Wilcox, W.F. (1989). First report of crown rot (Phytophthora cactorum) of strawberry in eastern North America. Plant Disease 73(2), 183. https://doi.org/10.1094/PD-73-0183E.
Received: Nov. 11, 2017 Accepted: Apr. 20, 2018 Addresses of authors:
Mustafa Munawar1,*, Anna Toljamo1, Frank Martin2 and Harri Kokko1
1 Department of Environmental and Biological Sciences, University of Eastern Finland, Yliopistonranta 1 E, 70211 Kuopio, Finland
2 United States Department of Agriculture, ARS, CA-93905 Salinas, USA
*Corresponding author; E-mail: mustafa.munawar@uef.fi
