ANTIBIOTIC RESISTANCE AND PROBIOTIC
PROPERTIES OF LACTIC ACID BACTERIA ISOLATED FROM CAMEL MILK AND SHUBAT
Gaukhartas Temirova MSc Thesis Green Biotechnology and Food Security University of Eastern Finland Faculty of Health Institute of Public Health and Clinical Nutrition Supervisors: Professor Atte von Wright and Dr. Jenni Korhonen 09.10.2016
Gaukhartas Temirova: Antibiotic resistance and probiotic properties of lactic acid bacteria isolated from camel milk and shubat
MSc thesis 40 pages
Supervisors: Atte von Wright and Jenni Korhonen September 1st 2016
Key words: lactic acid bacteria, probiotic properties, antibiotic resistance, medium, Lactobacillus
ABSTRACT
The aim of the study was to identify the lactic acid bacteria (LAB) isolated from camel milk and shubat, to assess their antibiotic resistance profiles and to characterize some of their probiotic properties. The LAB were tested against a set of antibiotics by broth microdilution method, according to standard operating procedures (SOP), and compared to recommendations of the European Food Safety Authority (EFSA). The probiotic properties, such as acid tolerance, bile tolerance and pancreatic enzyme tolerance and the capability to ferment milk, were subjected to testing. Thirteen strains were isolated from camel milk (n=8) and shubat (n=5). Antibiotic resistance profiling method was performed with two types of medium (LSM and MRS). The results turned out to depend on the medium used. MRS broth supported well the growth of LAB, but LSM broth produced more reliable results, particularly in the case of amoniglycoside antibiotics (kanamycin and streptomycin). To assess the probiotic properties, the strains were subjected to simulated intestinal stress factors (low pH, bile acids, pancreatic enzymes). After a 24 h incubation the viability (as CFU/ml) was assessed by plating. One Lactobacillus paracasei and two L. casei (018k-3 и 010k) showed high tolerance in these tests. Accordingly, three Lactobacillus strains could be used as potential antimicrobial probiotic strains against human pathogens and also as starter cultures.
Темирова Гаухартас: Устойчивость к антибиотикам и пробиотические свойства молочнокислых бактерий, выделенных из верблюжьего молока и шубата Магистерская работа, 40 страниц
Руководители: Атте вон Райт и Иенни Корхонен 1 сентября 2016
Ключевые слова: молочнокислые бактерии, пробиотические свойства, устойчивость к антибиотикам, среда, Lactobacillus
АБСТРАКТ
Цель исследования являлась идентифиция молочнокислые бактерии (МКБ), выделенных из верблюжьего молока и шубата, для оценки их профилей антибиотической активностии характеристики их пробиотических свойств. Молочнокислые бактерии были протестированы на группе антибиотиков путем метода двойной разведения, согласно стандартам процедурам (СОП) и в сравнении с рекомендациями Европейский руководства пищевых безопасности (ЕРПБ). Пробиотические свойства, такие как кислоты толерантности, терпимости желчи и ферментами кишечника, были подвергнуты тестированию. Тринадцать штаммы были выделены из верблюжьего молока (n= 8) и шубата (п = 5). Метод антибиотико резистентность профилирование проводили с двумя типами среды (LSM и MRS). Результаты оказались зависимы от используемой среды. Среда MRS хорошо влияет к росту молочнокислых бактерии, но от среды LSM были отмечены более стабильные результаты, особенно в отношение аминогликозидных (канамицин и стрептомицин). Для того чтобы оценить пробиотические свойства штаммов были подвергнуты смоделированные кишечные стресс- факторы (рН, желчных кислот, ферментов поджелудочной железы). После 24 часовой инкубации (как CFU/ml) был проведены измерение. Один L. paracasei 042k-2 и два L. casei (018k-3 и 010k) показали высокую толерантность в этих тестах. Соответственно, три штамма Lactobacillus могут быть использованы в качестве потенциальных антимикробных пробиотических штаммов против патогенов человека, а также как стартовые культуры.
Темирова Гаухартас: Түйе сүтінен және шұбаттан бөлініп алынған сүт қышқылды бактериялардың антибиотикке төзімділігін және пробиотикалық қасиеттерін зерттеу Магистірлік жұмыс, 40 бет
Жетекшілер: Атте вон Райт и Иенни Корхонен 1 қыркүйек 2016
Түйін сөздер: сүт қышқыды бактериялар, пробиотикалық қасиеттері, антибиотиктер, қоректік орта, Lactobacillus
ТҮЙІНДЕМЕ
Магистрлік диссертацияның негізгі мақсаты түйе сүтінен және шұбаттанбөлініп алынған сүтқышқылды бактериялардың антибиотикке төзімділігін анықтау және олардың пробиотикалық қасиеттерін сипаттау.Алынған сүт қышқылды бактерияларға екіншілік микро сұйылту әдісімен, (SOP) стандартты процедураға және Еуропалық тағам қауіпсіздігі (EFSA) ұсынысына сәйкес антибиотикке төзімділігін анықталды. Пробиотикалық қасиеттерін, оның ішінде қышқылға, өтке және асқазан ферментіне төзімділігі зерттелді. Зерттеуге алынған барлығы он үш штаммдары түйе сүтінен (N = 8) және шұбаттан (N = 5) бөлініп алынды.
Антибиотикке төзімділігін профильдеу әдісі арқылы екі түрлі қоректік ортаны (LSM және MRS) қолдану арқылы жүзеге асырылды. Зерттеу нәтижелері пайдаланылған қоректік ортаға тәуелді болып шықты. MRS қоректік орта сүт қышқылды бактериялардың өсуіне қолайлы жағдай туғызса, LSM қоректік ортасында өсуі нақты нәтижелері көрсетті. Сүт қышқылды бактериялардың пробиотикалық қасиеттері, оның ішінде қышқылға, өтке және асқазан ферментіне төзімділігі зерттелді. Аталған барлық зерттеулер нәтижесінде L. paracasei 042k-2, L. casei 018k-3 және L. casei 010k өсінділері өте жоғары төзімділігік көрсетті. Емдік- профилактикалық, пробиотикалық өнім алу үшін L. paracasei 042k-2, L. casei 018k-3 және L.
casei 010k өсінділерін қолдануға болады.
This work was done in the Institute of Public Health and Clinical Nutrition in the Faculty of Health, at the University of Eastern Finland during the academic year 2015-2016.
In particular, I would like to express my sincere appreciation and gratitude to my supervisor, Professor Atte von Wright, for his excellent guidance, comments, patience and caring. Sincere thanks also go to my other supervisor, Dr. Jenni Korhonen, for the help, support and for sharing her expertise on lactic acid bacteria and also always having time for skype meetings. My research would not have been possible without their help. My very sincere thanks to Laboratory Technicians Riitta Venäläinen and Kristiina Kinnunen for helping me when I worked in laboratory.
A very special thanks to my coordinator Roseanna Avento for her incredible support during my study in Finland and help in completing this thesis.
I would also like to thank the Kazakh National Agrarian University the Department of International Cooperation for the outstanding chance to go to study abroad. Special thanks to Professor Assiya Serikbayeva, Associate Professor Bayan Yesperova and Vice-Rector Ayup Iskakov for their support and care.
I would also like to thank my parents, brother and sister-in-law, for supporting me throughout all my studies at university. They believed in my success and power and they supported me all this time, spiritually and morally.
Amp Ampicillin
BLAST Basic local alignment search tool CFU Colony forming unit
Chlor Chloramphenicol
EFSA European Food Safety Authority Ery Erythromycin
Gen Gentamycin
GRAS Generally recognized as safe Kan Kanamycin
LAB Lactic acid bacteria
LSM Lactic acid bacteria susceptibility medium MIC Minimum inhibitory concentration
MRS de Man, Rogosa and Sharpe QPS Qualified presumption of safety SOP Standard operating procedures Str Streptomycin
Tet Tetracycline Van Vancomycin
ABBREVIATIONS ... 3
1. INTRODUCTION ... 8
2. LITERATURE REVIEW ... 10
2.1 LACTIC ACID BACTERIA ... 10
2.1.1 Biochemical properties ... 11
2.1.2 Antibiotic resistance of LAB ... 12
2.1.3 Traditional uses... 13
2.1.4 Probiotics and prebiotics ... 13
2.1.5 Prebiotics ... 15
2.1.6 Safety of prоbiotics ... 16
2.2 CAMEL MILK ... 16
2.2.1 Composition of camel milk ... 16
2.2.2 Production of camel milk in Kazakhstan ... 18
2.2.3 Shubat ... 19
3. OBJECTIVES... 20
4. MATERIALS AND METHODS ... 21
4.1 SAMPLING AND IDENTIFICATION OF ISOLATES ... 21
4.2 ANTIBIOTIC RESISTANCE PROFILING ... 22
4.3 PROBIOTIC PROPERTIES ... 23
4.3.1 Capability to ferment milk ... 23
4.3.2 Acid tolerance ... 23
4.3.3 Bile tolerance ... 23
4.3.4 Pancreatic enzyme tolerance ... 24
5. RESULTS ... 25
5.1 ANTIBIOTIC RESISTANCE PROFILING ... 25
5.2 PROBIOTIC PROPERTIES ... 28
5.2.1 Capability to ferment milk ... 28
5.2.2 Acid tolerance ... 28
5.2.3 Bile tolerance ... 29
5.2.4 Pancreatic enzyme tolerance ... 30
6. DISCUSSION... 31
7. CONCLUSIONS ... 34
1. INTRODUCTION
Lactic acid bacteria (LAB) are members of Lactobacillaceae family, the main feature of which is the ability to form lactic acid as a major fermentation product (Gasson and Shearman, 2003). Most probiotic strains of LAB are isolated from healthy human intestinal flora, and retain viability during passage through the gastrointestinal tract. They have a positive influence on human health, which is confirmed by clinical trials (Korhonen, 2010).
Accordingly, many LAB, isolated from fermented foods or human gut microbiota, are nowadays intentionally added to our food as probiotics. However, the safety status of any novel organism cannot be taken for granted, but has to be thoroughly investigated. These studies include the proper identification of the strains with genetic tools, such as 16S rDNA sequencing, metabolic and enzyme activities, and antibiotic resistance profiling (Feord, 2002). Besides these safety issues, the potential for the actual probiotic use has to be studied (Suqimoto and Sonomoto, 2011).
Camel milk is largely a subsistence product, and farmers focus on feeding themselves and their families with it. However, the production of camel milk in dairies may be a growing industry, and it is already sold in supermarkets in some countries, in the United States and Saudi Arabia, to mention a few examples (Danielsen and Wind, 2003). In Kazakhstan, camel milk and related products are used in households, and they can also be found in supermarkets. Shubat, for example, is a fermented drink made from camel milk and, a traditional drink of Kazakhstan. Shubat is obtained through spontaneous fermentation method, and a mixture of LAB and yeasts is found in the end product.
Moreover, shubat is not subjected to heat treatment leading to a mixed composition of microbes (Cherepanova et al., 1971).
Antibiotics are substances which are capable of preventing the development or inducing the death of certain microorganisms. Antibiotics that inhibit the growth and reproduction of bacteria are used as chemotherapeutic agents. Antibiotics are extremely useful and important both in medical and veterinary use, when properly applied (Hauser, 2012; Heymann,2007).
The use of antibiotics can be accompanied by negative side effects such as allergies and therefore many people avoid these antibacterial drugs, even in serious conditions. For these reasons antibiotics might lose their leading position among the most effective drugs to, for example, immunotherapy (Heymann, 2007).
The indiscriminate use of antibiotics in human medicine and in veterinary purposes and as growth promoters in animal husbandry has led to an increase of antibiotic resistances among both pathogens and commensal microorganisms. The situation is aggravated by the transmissible nature of many resistance genes, which threaten to reduce the therapeutic value of most currently used antibiotics.
Due to this situation, the European Union (EU) has forbidden the use of antibiotics as zootechnical growth promoters and aims to exclude the presence of transmissible antibiotic resistances in bacteria intentionally added into the food chain (EU regulation 1831/2003).
Probiotics, or live bacterial cultures that improve the health and wellbeing of the host, have become widely used both in human foods and as a replacement of antibiotic growth promoters in production animals (Hunter, 2008.). Most probiotics are either LAB or bifidobacteria, and traditional fermented products, such as shubat, could serve as a source for novel probiotic strains. However, a successful probiotic must fulfill certain criteria (Foschino, 2006). They should be able to survive the stress factors present in the gastrointestinal tract (low pH, bile acids), they should not carry exceptional antibiotic resistances and they should be technologically and organoleptically compatible with the intended food or feed application (Gomes et al., 2014).
2. LITERATURE REVIEW
2.1 LACTIC ACID BACTERIATraditionally lactic acid bacteria (LAB) have been defined as gram-positive, catalase negative, non- sporulating rods or cocci with a microaerophilic metabolism producing lactic acid as one of the major metabolic endproducts (Holzapfel and Wood, 2014).
LAB are typically either non-pathogenic or beneficial to humans (pathogenic streptococci and enterococci being a notable exception) (Lucke, 2013; Jay et al., 2006). LAB are often found in vegetable, dairy and meat products, in the intestines of animals and humans. Among the many microorganisms that possess practical value, they probably are the most important single group (Danielsen and Wind, 2003).
The first of researchers suggesting that some bacteria are not harmful to humans, and on the other hand, can have a positive impact on health, was a famous Russian scientist Ilya Ilyich Mechnikov (Yount, 2003). Early on in the 20th century, he conducted research on the possibility of recovery of the intestinal microflora using LAB (Caumette and Robert, 2015). As a result of serious and painstaking research a bacterium was characterized, which he called "Bulgarian bacteria" (in modern classifications – Lactobacillus delbrueckiissp. bulgaricus), and developed a recipe for a sour milk drink, a prototype of the modern yogurt (Know, 2014).
2.1.1 Biochemical properties
Fermentation of lactic acid has been known for thousands of years. Many different cultures have used this method of food processing to improve the storage quality, taste and nutritional value of perishable products such as milk, meat, fish and some vegetables (Dodd and Gasson, 1994).
Lactic acid fermentation is a biological process consisting glucose and other six-carbon sugars and also converted into cellular energy and the metabolite lactate. LAB metabolism is efficient carbohydrate fermentation coupled to substrate-level phosphorylation (Gasson and Shearman, 2003).
Adenosine triphosphate (ATP) can used for biosynthesis. LAB as a group exhibits an enormous capacity to degrade different carbohydrates and related compounds (Schleifer and Ludwig, 1995).
The process of converting carbohydrates into lactic acid is called lactic fermentation. Fermentation is carried out using LAB, which are classified into two large groups (depending on the nature of the fermentation) homofermentative and heterofermentative (Figure 1). Homofermentative lactic fermentation is caused by several species of Lactobacillus and Streptococcus. They can ferment various hexose sugars to yield predominantly lactic acidcarbon atoms (Forsythe, 2010).
Heterofermentative lactic acid fermentation is a more complex process than homo lactic fermentation leading to the formation of a number of compounds that accumulate depending on fermentation conditions. Some bacteria produce, in addition to lactic acid, ethyl alcohol and carbon dioxide, and acetic acid (Steinkraus, 2009). Some heterofermentative LAB can also form various alcohols, glycerol, mannitol (Baird-Parker, 2000).
However, to draw a sharp boundary between homo- and heterofermentative LAB based on fermentation a product pattern is sometimes difficult. Certain homofermentative strains of LAB from 8 to 30% by-products and heterofermentative bacteria under the influence of a number of factors can behave as homofermentative (Ray and Joshi, 2014). Many species and genera generally ferment hexoses homofermentatively and pentoses heterofermentatively.
Figure1.Fermentation pathways A: homofermentative LAB and B: heterofermentative LAB (Kandler, 1983)
2.1.2 Antibiotic resistance of LAB
Antibiotic resistance is present in many different bacterial species, including LAB, and the responsible genes are detectable in strains with resistant phenotypes. The susceptibility or resistance of LAB to antibiotics is defined by phenotypic methods (Patel et al., 2012). Although in most LAB species the antibiotic resistance is not a medical problem (because LAB do not cause infections), transmissible antibiotic resistance genes could be transferred from LAB to human or animal pathogens. Therefore, intentional use of antibiotic resistant LAB in food or feed is not advisable (Egervarn et al., 2007).
In the updated Guideline of the European Food Safety Authority (EFSA), LAB are categorized as resistant or susceptible by specific breakpoints according to species and genera (European Commission, 2008). For the assessment of antibiotic resistance two-fold serial dilutions in agar or broth should be used, and to include relevant quality control strains. These tests have to be performed following the internationally recognized standards, such as provided by Clinical and Laboratory Standard Institute, ISO standard or similar (EFSA, 2012).
2.1.3 Traditional uses
Traditional fermentation is a method of food processing, in which microbes like LAB are utilized.
The bacteria are added to food and allowed to multiply and metabolize the nutrients present in fermentable foodstuffs (El-Agamy, 2008). The processes are known since ancient times and have become the cultural and traditional norm around the world. General population prefers fermented foods because of their pleasant taste, texture and color (Aderiye and Laleye, 2003).
Different kind of food fermentations are classified by the major fermentation end products. Examples are alcoholic fermentation, lactic acid (non-alcoholic) fermentation, acetic acid fermentation, alkaline fermentation and amino acid fermentations (Anukam and Reid, 2009).
Typical foods that are produced by lactic acid fermentation include fermented milks (such as yoghurt, buttermilk, kumys, shubat), cheeses, pickled vegetables (gherkins, sauerkraut), sausages and cured meats (Ray and Joshi, 2014).
Traditionally fermented foods were prepared either by relying on spontaneous fermentation or by backslopping (inoculating, for example, a fresh batch of milk with old, fermented yoghurt).
Nowadays, in industrial production, well defined starter cultures with known species and strain composition are mainly used (Gill and Prasad, 2007).
2.1.4 Probiotics and prebiotics
Currently the term “probiotic” has been coined to describe “live micro-organisms which, when administered in adequate amounts, confer a health benefit on the host” (FAO/WHO, 2002). LAB and bifidobacteria are the two most common bacterial groups that are used in probiotic foods and formulations. The probiotic LAB are often so called “eubiotics” (representatives of the normal microflora of the intestines and other body cavities) (Fung et al., 2011).
Alternative definitions of probiotics include that of Mindell (2004): “Medications or biologically active food additives that contain live microorganisms, which are representatives of the normal human flora.
Carroll et al. (2010) defined probiotics as drugs and foods, which contain substances of microbial and non-microbial origin, providing with the natural method of introducing beneficial effects on physiological functions and biochemical host response by optimizing its microecological status (i.e.
any living, dead microorganisms, their structural components, metabolites other origin substances that have a positive impact on the functioning of the host microflora) (Foschino, 2006).
Probiotics or health promoting microorganisms can be widely used for the prevention and treatment of various diseases. The formulation of these microorganisms is variable (dairy products, medicines, dietary supplements) and the choice should be guided primarily by the fact that the positive effect on the human body has to be clinically proven not only for the LAB strain, but also for finished products, containing these bacteria ( Liao, 2012).
Probiotic microorganisms are widely used as nutritional supplements as well as in yogurt and other dairy products (Cho and Finocchiaro, 2010). Microorganisms that are intended to be used as probiotics should not be pathogenic or toxigenic and they should retain viability during passage through the gastrointestinal tract and during storage. Probiotics are not considered drugs, but they are meant to affect positively to people´s health status (Giovanna et al., 2015).
2.1.4.1 Documented health effects of probiotics
Most probiotic strains have been isolated from healthy human intestinal flora (bifidobacteria and lactobacilli) and retain viability during passage through the gastrointestinal tract having a positive influence on human health, confirmed by clinical trials. They are administered in the pharmaceuticals, food additives, and more recently dairy products. Current trends are such that the final form thus enriched products should also have clinically proven positive effects on the human body (Gibson et al., 1997).
Studies on the efficacy of probiotics in various diseases of people of different age groups have been conducted for many decades. The use of probiotics has been investigated in various diseases of the digestive system for example, constipation, irritable bowel syndrome, chronic inflammatory bowel disease, malabsorption of lactose (lactase deficiency), and in diseases associated with upper respiratory tract infections (Usman, 2015).
The most evident positive impacts of probiotics have been observed in acute intestinal infections - in these cases, they help to reduce the duration of illness and rehabilitation of the intestinal mucosa.
Their positive effect, for example, in cases of diarrhea caused by antibiotic treatment, as well as in
"travel sickness" – diarrhea have been demonstrated (Chikne and Chiplunkar, 2014).
There are also indications of the efficiency of probiotics in the treatment of atopic dermatitis.
Currently, in the fight against this disease, probiotics act as an additional therapeutic agent (Shortt et al., 2012).
2.1.5 Prebiotics
Prebiotics refer to substances or dietary supplements, which are mostly not absorbed in the human intestine, but are beneficial to the body by selectively stimulating the growth and (or) the activation of microorganisms (Otles and Ozyurt, 2013; Lee, 2009). Prebiotics in humans are dietary carbohydrates that have not been digested in the upper gastrointestinal tract (Zoetendal and Mackie, 2005).
Prebiotics are usually found in foods, are present in breast milk, and can also be isolated from plants or synthesized. There are various kinds of prebiotics contained in dairy products and other vegetable products. Prebiotics are useful in increasing the number of anaerobic bacteria and reducing the population of potentially pathogenic microorganisms. Widely studied prebiotics are inulin, fructo-, galakto- and xylooligosaccharides (Cho and Finocchiaro, 2010).
Probiotics and prebiotics can both be used to maintain and restore the normal, health promoting intestinal microbiota. They can be administered in different food matrices milk and dairy products being perhaps most common, because of the long association of LAB and milk, which makes these products both familiar to consumers and easy to manufacture (Serikbayeva et al., 2004).
2.1.6 Safety of prоbiotics
The probiotic products based on LAB and bifidobacteria are characterized generally safe when used in humans (Kajfasz and Quivey, 2011). Most of the currently known probiotic microorganisms are part of the normal microflora present in foods consumed for several generations of people worldwide (von Wright and Salminen, 2011). Consequently LAB and bifidobacteria are not generally associated with infections or any pathogenicity traits (Mogensen et al., 2002).The International Dairy Federation (1995) considers that probiotics are generally safe, including lactobacilli and bifidobacteria.
However, there have been rare occasions of infections associated with LAB (including also probiotic strains), which underscore the importance of the proper characterization of probiotic strains (Besselink et al., 2008). Infection cases and detrimental effects are extremely rare and basically in immunocompromised subjects or subjects with hepatitis as a severe underlying condition (von Wright and Salminen, 2011).
2.2 CAMEL MILK
2.2.1 Composition of camel milk
Milk is - a biological fluid of complex chemical composition, released by the mammary gland of mammals (Serikbayeva, 2009a). This multicomponent system is balanced, has a high nutritional, immunological and bactericidal properties (Aralbayev, 2009). For people milk is an indispensable and biologically high-grade food. The quantitative and qualitative composition of milk can vary greatly different representatives of mammals. It is determined by the type of a mammal depends upon the speed of growth of the baby, the duration of the milk-feeding period, ambient temperature and other factors (Toktamisova, 2000). Camel milk has several proteins, fat, lactose, albumin, ash, macro - and microelements like сalcium and phosphorus (Table 1) (Serikbayeva, 2009a).
Table 1. Composition of camel milk (Serikbayeva, 2009a).
Water Proteins Fat Lactose Albumin Ash Calcium Phosphorus
85-87% 2.8-3.1 % 3.2% 4.7-5.2% 0.67% 0.70% 0.25% 0.37%
Camel milk is used for the preparation of various dishes, as well as a standalone drink. Camel milk contains antibacterial agents that help maintain its freshness, even in hot weather conditions. The bactericidal properties of milk prevent the growth of pathogenic microorganisms (Ramet, 2001).
The composition of camel milk can be compared with milks from other species (Table 2). There is little difference between camel milk and cow milk. However, camels are known to produce more concentrated milk in hot weather when water is scarce (Farah, 2004). Milk sugar (lactose) is synthesized in the udder of lactating animals. Lactose is an energy source for the biochemical processes in the body, promotes the absorption of calcium, phosphorus, magnesium, barium. Under the influence of lactobacilli, lactose cleaved to form lactic acid, which promotes absorption of calcium and phosphorus needed for the formation of growing animal bones. The content of lactose in camel milk is generally comparable to fat or protein contents (Serikbayeva et al., 2004).
Table 2. Composition of milk from various animal species (Farah, 2004).
Water, % Fat, % Lactose, % Protein, % Ash, %
Camel 86-88 2.9-5.4 3.-5.8 3.0-3.9 0.6-1.0
Cow 86-88 3.7-4.4 4.8-4.9 3.2-3.8 0.7-0.8
Goat 87-88 4.0-4.5 3.6-4.2 2.9-3.7 0.8-0.9
Sheep 79-82 6.9-8.6 4.3-4.7 5.6-6.7 0.9-1.0
Human 88.0-88.4 3.3-4.7 6.8-6.9 1.1-1.3 0.2-0.3
The levels of vitamins B12, C and D in camel milk are higher than in cow milk (Narmuratova et al., 2006) (Table 3). Compared to bovine milk, camel milk has a slightly more salty taste. Camel milk also has less fat and cholesterol than cow milk, and the milk is a good source of protein and unsaturated fatty acids (Narmuratova et al., 2006).
Table 3. Some vitamins in cow and camel milk (Narmuratova et al., 2006).
Vitamin A, ml/L Vitamin B12, ml/L Vitamin C, ml/L
Camel milk 0.38 2.72 67.5
Cow milk 0.20 2.40 45.0
2.2.2 Production of camel milk in Kazakhstan
The Kazakhs have long considered camel as the most important among the four types of domesticated animals, cow, horse and sheep. The Republic of Kazakhstan is traditionally one of the world's leading producers of camel milk (Zharkinbaev and Serikbaev, 2004). In recent years there has been a steady growth in the number of camels. There were 125 000 heads of camels in 2004, whilein 2010 population amounted to 158 000 heads, meaning a dramatic increaseby 26.1% in six years (Serikbayeva, 2009b). The current population of camels in Kazakhstan is 165 000 heads (Figure 2).
Figure 2. Number of camels in Kazakhstan (Serikbayeva, 2009b).
Camel production is an important economic activity in the arid and semi-arid lands of Kazakhstan, which faces challenges in terms of high demand for camel milk, which cannot be met at current production levels (Narmuratova et al., 2006).
Dairy products from camel milk made in Kazakhstan have already created interest of the global dairy industry companies in Western Europe, USA and Australia. Camel meat in Kazakhstan is mainly used as food by the local population. They have developed a unique production technology (for example camel sausages) and products, which can become brands in the global meat production (Serikbayeva et al., 2006).
125000
158000
165000
0 20000 40000 60000 80000 100000 120000 140000 160000 180000
2004 2010 2015
2.2.3 Shubat
Shubat is a beverage produced from natural camel milk as a result of lactic acid and alcoholic fermentation. It is the traditional drink of Kazakhstan. The technology of making shubat is not particularly difficult. A starter is added into a sack made of leather (torsyk) or into a vessel made of wood followed by addition of fresh camel milk, and the mixture is allowed to acidify. Just before serving, cooked shubat is mixed thoroughly (Kurzhembaeva, 2010).
At the beginning of the season, in the absence of good shubat starter for camel milk fermentation, a special starter is required, which typically includes three types of microorganisms: Lactobacillus casei, Streptococcus thermophilus, lactic acid streptococci and yeast of the genus Torula (Serikbayeva et al., 2006).
The microbiological composition of shubat starters has been studied by Shigaeva and Ospanova (2008). Analysis of different shubat samples from Kyzyl-Orda region produced 30 cultures of LAB, two kinds of Lactobacillus bulgaricus and Lactococcus (Streptococcus) lactis. The species composition of LAB in shubat was not different from that of koumiss. Koumiss is a fermented drink made from mare's milk having a whitish color, based on lactic acid and alcoholic fermentation. L.
bulgaricus, L.casei, and L.lactisare considered responsible for the lactic fermentation both in koumiss and in shubat (Musayev and Serikbayeva, 2004).
In general, the composition of shubat is still poorly understood (Toktamisova, 2000). The contents, carbohydrates and end products in shubat have not been well studied but Narmuratova et al, 2009 have done some preliminary analysis (Table 4.) According to Serikbayeva (2009b), the content of lactose in shubat 1.79% and that of the amount of these substances depends upon shubat maturation (Serikbayeva, 2009b). Furthermore, Narmuratova et al., (2009) determined the alcohol content of shubat as 0.68% and that shubat contains 2.8-3.8% protein, most of which is casein.
Table 4.Composition of shubat (Narmuratova et al.,2009) Water,% Proteins,
%
Fat, % Lactose, % Casein, % Ash, % Vitamin C, ml/L
85-87 3.72 5.70 2.60 2.93 0.64 58.25
3. OBJECTIVES
The aims of the study are to identify LAB isolated from camel milk and shubat, to assess their antibiotic resistance profiles and to characterize their probiotic properties.
To complete this, the following tasks were studied:
1. The LAB previously isolated from camel milk (n = 8) and shubat (n = 5) was identified using 16S rDNA sequencing. The obtained sequence was compared with the databases, such as BLAST, and the gained sequence data was sent to databases.
2. The LAB was tested against a set of antibiotics by broth microdilution method, according to standard operating procedures (SOP) and compared to EFSAs recommendations.
3. The probiotic properties, such as the capability to ferment milk, acid tolerance, bile tolerance and pancreatic enzyme tolerance, were subjected to testing.
In conclusion, based on these experiments, the usefulness of these bacterial isolates to be used as probiotic strains will be discussed.
4. MATERIALS AND METHODS
4.1 SAMPLING AND IDENTIFICATION OF ISOLATES
The isolates from camel milk and shubat (Table 5) were isolated in previous studies. The isolates were cultivated on MRS broth and agar plates and incubated at 30 °C for 48 h in aerobic conditions.
The isolates were tentatively identified by gram staining, catalase and oxidase tests, and sugar fermentation profiles by API CHL (BioMerieux). The species identification was based on the 16S rDNA sequencing.
Table 5. Bacterial strains isolated from camel milk and shubat.
The DNA of the isolates (n = 13) was extracted by using a NucleoSpin Tissue kit from Macherey Nagel. Additional lysis steps was applied according to manufacturer´s instructions. The DNA was amplified by universal primers 27F (5´AGAGTTTGATCCTGGCTCAG´3) and 685R (5´TCTACGCATTTCACCGCTAC´3) in a PCR reaction, using a reaction mixture of 1 x buffer, 3 mM MgCl2, 0,2 mMdNTP, 2 µM primers and 0,1 U GoTaqpolymerase (Promega). After 6 min denaturation at 94 °C the PCR consisted of 30 cycles (1 min denaturation at 94 °C, 1 min annealing at 54 °C and 1 min extension at 72 °C), followed by 10 min further extension at 72 °C. After gel electrophoresis (1 % TAE buffer with SybrSafe DNA Gel Stain) the PCR products were cleaned using MN NucleoSpin Gel and PCR Clean Up kit (Macherey-Nagel). The PCR products were sent to sequencing to LGC Genomics, Germany. The obtained sequences were identified using BLAST, The Basic Local Alignment Search Tool.
Camel milk Shubat
L. casei 08ch-1 L. fermentum Shu 1
L. paracasei 042k-2 Enterococcus faecium Shu 3
L.casei 015-k L. fermentum Shu 4
L.casei 018k-3 L.fermentum Shu 5
L. casei 010k Enterococcus faecium/durans
L. casei 021ch-4 L. casei/paracasei 05 L. casei/paracasei 021-4
4.2 ANTIBIOTIC RESISTANCE PROFILING
The antibiotic resistance profiles were determined by the broth microdilution method. Firstly, the antibiotic stock solutions (1024 µg/ml) and dilution series starting from 64 µg/ml in sterile water were prepared in two-fold series. Then 100 µl of appropriate dilutions of antibiotics were pipetted to 96 – well microtitreplates. Next, the overnight grown bacterial suspensions in MRS -broth (with the absorbance of A625 0,16-0,2; corresponding to a cell count of 108cfu/ml) was diluted 1:100 and aliquots of 100 µl were also added to microtitre plates. The plates were incubated at 30 °C for 48 hours in aerobic conditions, after which the results were read. Based on the growth, the MIC (minimum inhibition concentration) value was determined as the lowest concentration of the antimicrobial that inhibits bacterial growth.
For quality control, LAB species of known resistance profiles were used, as well as the positive bacterial (bacterial suspension, no antibiotics) and negative broth (no bacterial suspension, no antibiotics, but only MRS growth medium) controls. The individual tests were done in triplicate, and the tests were repeated thrice independently, to assure the reliability of the results.
The antibiotics used in the tests were chosen according to EFSA scientific opinion (2012), which consists of the guidance on the assessment of bacterial susceptibility to antimicrobials of human and veterinary importance. The eight antibiotics were ampicillin, vancomycin, gentamicin, kanamycin, streptomycin, erythromycin, tetracycline and chloramphenicol.
4.3 PROBIOTIC PROPERTIES 4.3.1 Capability to ferment milk
The capability to ferment milk was tested using 10 % Skimmed Milk Powder (Labema). 10 ml of liquid skim milk was inoculated by 100 µl of overnight culture and incubated 24 hours at 37 °C, after which the fermentation capacity was estimated by naked eye. Moreover, the viscosity of the suspensions was measured by viscosimetry. Viscosimetry (PCE Instruments, Rotary Viscometer PCE-RVI3, Model 20, UK).
4.3.2 Acid tolerance
Acid tolerance assay have been tested in accordance with Ehrmann et al. (2002). Cells of each LAB strain in a last concentration should be of 7 to 8 log CFU/ml PBS, and cells of each LAB strain was seed into sterile PBS with neutral pH 7.2 (control) and adjusted to рH 3 with 1 M НСl (acidic condition). After this process, they were maintained anaerobically for 3 hour at 37°С. Next step ten times serial dilutions (up to 10−7) of every bacterial strain was made using PBS. So 100 μL of 10-4 to 10-7 dilutions from each species was spread-plated on MRS agar and incubated anaerobically at 37°С for 24 hours. After incubation, samples on the plates were calculated and by comparing number of viable cell after the action to acidic (рН 3) and normal (control) conditions.
4.3.3 Bile tolerance
Bile tolerance analyses have been conducted according to Jacobsen et al. (1999). Overnight culture of each LAB strain, make prepared to a last concentration of 7 to 8 log СFU/ml, was seed (1%, v/v) into 10 ml of fresh МRS broth with or without 0.3% ox gall and incubated anaerobically at 37°C for 4 hours, then which ten times serial mixture of up to 10-7 was made using PBS. Processing of 100 μL of 10-4 to 10-7 dilutions from each species was spread-plated on MRS agar and incubated anaerobically at 37°С for 24 hours. After incubation, viability of bacterial cells were evaluated using colony counts on the plates and after this process bile tolerance was assessed by comparing number of viable cell in МRS with and without bile.
4.3.4 Pancreatic enzyme tolerance
Pancreatic enzyme tolerance was tested according to the procedure of Ronka et al. (2003). Assembled cell pellet of overnight culture of each LАB strain was re-suspended in РBS to a last mass concentration of 7 to 8 log СFU/mL and 1% of weighted cells were inoculated into 10 mL of the test liquid (РBS containing 150 mМ NaHCО3 and 1.9 mg/mL pancreatic (Sigma, USA), pH 8 and final solution (PBS, pH 7.2). Next step of process cultures were incubated anaerobically at 37°С for 3 һour. Accordingly, ten times serial dilutions of up to 10-7 were made using РBS and 100 μl of 10-4 to 10-7 dilutions from each pattern and spread-plated on MRS agar. After incubation, viability of bacterial cells was evaluated by colony numbers (СFU/ml). Final of process tolerance to pancreatic enzymes was measured by comparing number of viable cell in test solution and control solution.
5. RESULTS
5.1 ANTIBIOTIC RESISTANCE PROFILING
Determination of sensitivity was conducted using dilutions defining minimum inhibitory concentration (MIC) of antibiotics against bacteria in the study. Antibiotic resistance profiling method was done in two different types of medium (MRS and LSM). The results turned out to depend on the medium used. МRS broth supports the growth of LAB, but LSM broth produced more reliable results, particularly in the case of aminoglycoside antibiotics (kanamycin and streptomycin).
Results from ampicillin showed differences between strains isolated from camel milk and strains isolated from shubat (Table 6). This implies that strains isolated from camel milk are more resistance to antibioticsthan strains isolated from shubat. Further, all strains demonstrated high resistance to vancomycin and kanamycin. However all isolated strains showed low resistance to erythromycin (Table 6).
Table 6.Antibiotic resistance profiles of tested bacteria isolated from camel milk and shubat grown in MRS broth, for 48 h, at 30°C
Bacterial strain
Distribution of MICs (μg/ml)
Ampicillin Vancomycin Gentamycin Kanamycin Streptomycin Erythromycin Tetracycline Chloramphenicol
L. casei 08ch-1 2 > 64 32 64 16 <0.5 8 1
L. paracasei 042k-2 2 > 64 16 64 16 <0.5 2 2
L.casei 015-k 2 > 64 32 64 8 <0.5 2 2
L.casei 018k-3 2 > 64 32 >64 8 <0.5 2 2
L. casei 010k 2 > 64 32 >64 8 <0.5 <0.5 2
L. casei 021ch-4 2 > 64 16 >64 8 <0.5 2 2
L. fermentum Shu 1 <0.5 > 64 16 >64 32 <0.5 16 2
E. faecium Shu 3 <0.5 > 64 8 32 16 <0.5 8 2
L. fermentum Shu 4 <0.5 > 64 32 >64 32 <0.5 16 4
L. fermentum Shu 5 <0.5 > 64 16 >64 32 <0.5 32 2
E. faecium Shu 6
<0.5 > 64 8 32 16 <0.5 16 4
Isolate resistance to ampicillin in LSM broth (Table 7) is similar with those achieved MRS broth (Table 6). On the other hand, all strains showed low resistance to erythromycin and chloramphenicol.
LSM broth provided more reliable results and it is concluded that strains isolated from camel milk more resistance than strains isolated from shubat.
When tested with LSM medium, all strains were highly resistant to vancomycin MIC ≥ 64 µg/ml (Table 7), except E. faecium Shu 3 and L. fermentum Shu 4, which had a MIC value of 1 µg/ml.
However, testing of vancomycin with L casei, L. paracasei and L. fermentumis not required according to EFSA (2012), since these particular species have been found to carry intrinsic resistance to vancomycin, and the resistance is estimated not to carry a potential risk of horizontal spread.
When compared with the recommendations given by EFSA (2012) in their Guidance on the assessment of bacterial antimicrobial susceptibility, all tested strains were susceptible to all testes antibiotics in their particular categories, except all three tested L. fermentum strains (Shu 1, Shu 4 and Shu 5), which exceeded the given MIC value in case of chloramphenicol (Table 7). However, the tested value 8 µg/ml is very near to given microbiological cut-off value (4 µg/ml) by EFSA
Table 7. Antibiotic resistance profiles of tested bacteria isolated from camel milk and shubat grown in LSM broth, for 48 h, at 30°C
Bacteria strains
Distribution of MICs (μg/ml)
Ampicillin Vancomycin Gentamycin Kanamycin Streptomycin Erythromycin Tetracycline Chloramphenicol
L. casei 08ch-1 1 >64 <0.5 1 <0.5 <0.5 8 2
L. paracasei 042k-2 2 >64 2 32 8 <0.5 4 8
L.casei 015-k 2 >64 2 32 4 <0.5 1 8
L.casei 018k-3 2 >64 2 16 8 <0.5 1 8
L. casei 010k 2 >64 2 32 16 <0.5 1 8
L. casei 021ch-4 2 >64 4 32 16 <0.5 2 8
L. casei/paracasei 05 2 >64 2 32 16 <0.5 2 8
L. casei/paracasei 021-4 2 >64 4 32 16 <0.5 1 8
L. fermentum Shu 1 <0.5 >64 4 >64 64 <0.5 4 8
E. faecium Shu 3 <0.5 <0.5 4 16 32 <0.5 1 8
L. fermentum Shu 4 <0.5 <0.5 4 8 16 1 1 8
L. fermentum Shu 5 <0.5 >64 1 16 8 <0.5 4 8
E. faecium Sh 6 <0.5 >64 <0.5 16 16 <0.5 8 8
5.2 PROBIOTIC PROPERTIES 5.2.1 Capability to ferment milk
The capability to ferment milk was tested in sterile skimmed milk. 1 % inoculum of fresh overnight bacterial culture was inoculated to 10 ml of milk and incubated 48 h at 30 °C. When estimated by naked eye, all strains were fermenting milk (milk was coagulated) except L. paracasei 08ch-1, L.
fermentum Shu 1 and L. fermentum Shu 5, which did not coagulate milk. As a control strain, Lactobacillus rhamnosus GG was used in the studies. When studied by viscosimetry, the strains which did not coagulate milk had a value of less than 14,5 % (viscosimetry value 29 100).
5.2.2 Acid tolerance
The acid tolerances of L. paracasei 042k-2 reduced with -0.21 log unit. L.casei 08ch-1, L. casei 018k- 3, L. casei 010k, L.casei 021ch-4, L. casei/paracasei 05, L. fermentum Shu 4 and L. fermentum Shu 1 retained their viable cell numbers with slight losses in cell viability of 0.0 - 0.22 log units. Other strains L. casei 015-k, L. casei/paracasei 021-4, E. faecium Shu 3, L. fermentum. Shu 5 and E.
faecium/durans Shu 6 were more sensitive with loss in cell viability of 0.32 - 0.68 log units (Table 8).
Table 8. Viability of tested strains (log CFU/mL) against acidic conditions.
Bacterial strains
Cell viability ( log CFU/mL) Reduction in cell viability (log units)
pH 7.2 pH 3
L. casei 08ch-1 6.54 6.47 0.07
L. paracasei 042k-2 6.47 6.68 -0.21
L.casei 015-k 7.05 6.70 0.35
L.casei 018k-3 7.27 7.11 0.16
L. casei 010k 7.31 7.11 0.20
L. casei 021ch-4 6.80 6.58 0.22
L. casei/paracasei 05 8.06 7.90 0.16
L. casei/paracasei 021-4 8.27 7.65 0.62
L. fermentum Shu 1 8.0 7.95 0.05
E. faecium Shu 3 7.76 7.44 0.32
L. fermentum Shu 4 7.85 7.80 0.05
L. fermentum Shu 5 7.99 7.64 0.35
E. faecium Shu 6 8.03 7.35 0.68
5.2.3 Bile tolerance
Bile tolerance method was also determined as reduction in cell viability based on CFU/ml count.
Table 11 illustrates the range of responses to bile salt. A modest decrease in cell viability of 0.01 - 0.32 log units was considered a good tolerance. Hence L. casei 08ch-1, L.casei 021ch-4, L.
casei/paracasei 05, L. casei/paracasei 021-4, L. fermentum Shu 1, E. faecium Shu 3, L. fermentum Shu 4, L. fermentum. Shu 5 and E. faecium/durans Shu 6 had a lower tolerance to bile salt, with reduction in cell viability of 0.68 – 2.61 log units (Table 9).
Table 9. Viability of tested strains (log CFU/mL) against bile acids (0.3 % bile salt).
Bacterial strains Cell viability ( log CFU/mL) Reduction in cell viability
(log units)
MRS MRS + 0.3 % bile
salt
L. casei 08ch-1 8.08 7.04 0.68
L. paracasei 042k-2 7.35 7.03 0.32
L.casei 015-k 7.80 7.67 0.13
L.casei 018k-3 7.86 7.78 0.08
L. casei 010k 7.25 7.01 0.24
L. casei 021ch-4 7.70 6.74 0.96
L. casei/paracasei 05 7.46 6.63 0.83
L. casei/paracasei 021-4 7.87 6.89 0.98
L. fermentum Shu 1 8.66 6.05 2.61
E. faecium Shu 3 9.25 8.01 1.24
L. fermentum Shu 4 8.53 7.30 1.23
L. fermentum Shu 5 8.47 7.47 1.00
E. faecium Shu 6 9.16 7.70 1.46
5.2.4 Pancreatic enzyme tolerance
Table 10 indicates that L. casei 08ch-1, L. paracasei 042k-2, L. casei 018k-3 and L. casei 010k showed high tolerance to pancreatic enzymes with reduction in cell viability of only 0.07 - 0.19 log units. In contrast, L. casei 021ch-4, Lactobacillus spp. Shu 3 and Enterococcus faecium/durans had lower tolerance to the pancreatic enzymes with the reduction in cell viability of 0.21 -1.43 log units (Table 10).
Table 10. Viability of Lactobacillus strains (log CFU/mL) PBS with and without (control) 1.9 mg/mL pancreatic enzyme.
Bacterial strains Cell viability ( log CFU/mL) Reduction in cell
viability (log units) pH 7.2 (control) 1.9 mg/mL
pancreatic enzyme
L. casei 08ch-1 6.94 6.75 0.19
L. paracasei 042k-2 7.23 7.07 0.16
L.casei 015-k 7.77 7.02 0.75
L.casei 018k-3 7.62 7.52 0.10
L. casei 010k 7.47 7.35 0.12
L. casei 021ch-4 6.54 7.76 1.22
L. casei/paracasei 05 7.81 7.60 0.21
L. casei/paracasei 021-4 7.57 7.20 0.37
L. fermentum Shu 1 7.20 6.90 0.30
E. faecium Shu 3 8.50 7.07 1.43
L. fermentum Shu 4 7.15 6.90 0.25
L. fermentum Shu 5 7.13 6.83 0.30
E. faecium Shu 6 8.30 7.13 1.17
6. DISCUSSION
The traditional Central Asian, fermented drinks kefir, koumiss and shubat contain different kinds of microorganisms.
In this study, Lactobacillus strains isolated from camel milk (L. casei 08ch-1, L. paracasei 042k-2, L. casei 015-k, L. casei 018k-3, L. casei 010k, L. casei 021ch-4, L. casei/paracasei 05, L.
casei/paracasei 021-4 and Lactobacillus and Enterococcus species isolated from shubat (L.
fermentum Shu 1, E. faecium Shu 3, L. fermentum Shu 4, L. fermentum Shu 5, E. faecium/durans Shu 6 were evaluated for antibiotic resistance and acid, bile and pancreatic enzyme tolerance.
Due to the risk of antibiotic resistance genes being transferred horizontally from LAB to pathogens, the current EU regulations require that the LAB used in the food and feed manufacture should be sensitive to antibiotics of clinical or veterinary importance (EFSA 2012).
In this study, the antibiotic resistance profiling was tested using two different medium (MRS and LSM). When tested with MRS medium, all strains showed resistance to kanamycin (MIC values >
64 µg/ml), except both E. faecium strains which remained susceptible. According to EFSA, vancomycin is not required for testing with L. fermentum or L. casei/paracasei strains, but for enterococci. Hence, vancomycin resistance (MIC ≥ 64 µg/ml) was present in both E. faecium strains when tested with MRS medium.
All strains were susceptible to ampicillin, streptomycin, erythromycin and chloramphenicol (Table 4), when tested with MRS medium. Results of antibiotic resistance profiling with LSM medium showed more reliable results, particularly in the case of aminoglycoside antibiotics (kanamycin). The outcome illustrates the need of using correct media and standardized growth conditions in order to get reliable results in MIC determinations. This has been demonstrated also in the study by Egervarn et al., (2007), in which it was shown that the inoculum size and the incubation time both have a critical influence on the broth microdilution susceptibility testing and results obtained from LAB.
Most of the Lactobacillus isolates were susceptible to all of the antibiotics examined in this thesis.
The only exception was chloramphenicol, which showed slight resistance of 8 µl/mL when applied with all three L. fermentum strains used in this study. In previous studies with LAB isolated from calves, the most often encountered resistance was against tetracycline together with kanamycin in Lactobacillus species, but no multidrug resistances were found (Korhonen, 2010). This is also the case in this study.
Physiological characteristics of selected strains of Lactobacillus, which is characterized by high levels of resistance to vancomycin and multidrug resistance to various antibiotics, reduced sensitivity to lysozyme, lysostaphin and a cationic low molecular weight peptide Varnerin. Characteristic for this strain is the bacterial cell wall thickening, leading to a significant reduction in the rate of absorbtion of vancomycin from cell culture medium, and restricted access to antibiotic targets on the bacterial membrane. Thus, the physiological vancomycin resistance in Lactobacillus is probably due to a number of metabolic alterations due to genetic changes in these strains accumulated for a long time.
There is a hypothesis that the change in the physiology of Lactobacillus in the accumulation of mutations leads to vancomycin resistant phenotype. Indeed, a significant amount of genetic analysis of Lactobacillus strains with increased resistance to vancomycin have showed impaired expression of many genes (Hauser, 2012). The first cases of this resistance have been described in France in 1988, and now vancomycin-resistant enterococci are common throughout the world (Tillotson, 2007).
In addition to antibiotic resistance profiling, one of the other important areas of study is to determine the ability of microorganisms to survive in the gastro-intestinal tract after passage through the esophagus. It is known that LAB are Gram-positive bacteria, and they tend to be less resistant to bile acids than Gram-negatives.
To evaluate survival in aggressive environments, all strains used in this study were subjected to acid and ox bile exposure. In general, L. casei and L. paracasei strains isolated form camel milk showed higher tolerance to low pH, bile acids and pancreatic enzymes. Actually, L. paracasei strain 042k-2 showed higher survival in acid pH than in neutral pH. This demonstrates well the adaptation of LAB in the acidic conditions present in gut and intestines of humans and animals. Moreover, L. fermentum strains isolated from shubat were found to tolerate acidic conditions and pancreatic enzyme quite well, but on the opposite they were not very successful in tolerating bile acids.
The bile acid tolerance was markedly worse in isolates derived from shubat than from camel milk.
This is most likely because of the different bacterial strains, not only the environment where the strains are originated.
In another study five isolates, namely E. durans, L. casei, E. lactis, P. pentosaceus and W. cibaria, showed high tolerance against acid conditions. Also, four isolates, namely E. durans, E. faecium, L.
casei and P. pentosaceus, demonstrated excellent capacity and one isolate, namely E. lactis, demonstrated good capacity to resist bile salts reported by Davati et al. (2015). These studies together with the results obtained here indicate that the ability to survive gastrointestinal stress is not uncommon in LAB, even when, as in the studies reported here, the LAB were not of intestinal origin.
7. CONCLUSIONS
ANTIBIOTIC RESISTANCE PROFILING
LSM medium used in the tests showed to give more reliable results than results obtained from MRS medium, which can be concluded when comparing results from this study to results obtained from literature. This founding with usefulness of LSM is in line with previous studies (Klare et al. 2005).
No multidrug resistances were found in this study. This may indicate a low level of antibiotic resistances among the bacterial strains in camel milk and shubat, but no further conclusions can be made since the limited number (n=13) of isolates used in this study.
When applied with LSM medium, the only resistance according to EFSAs recommendations (2012) found was chloramphenicol with Lactobacillus fermentum strains isolated from shubat. However, the level of resistance is only one dilution step up from the MIC value, and can be considered as not significant. When testing antibiotic resistances, the accurate identification of isolates is of utmost importance. This is clearly shown in the results with chloramphenicol. The level 8 µg/mL is considered resistant when applied with L. fermentum, but the same level 8 µg/mL is considered susceptible when applied with L. casei and L.
paracasei.
PROBIOTIC PROPERTIES
The reduction of viable cell counts was found to be quite limited. In almost all cases the cells remained their viability during the exposure to stressful conditions (low pH, bile and pancreatic enzyme). The best candidates for further investigations would probably be the L.
casei and L.paracasei isolated from camel milk. Accordingly, these Lactobacillus strains could be used as potential antimicrobial probiotic strains against human pathogens and also as starter cultures after demonstrating their safety in clinical studies.
The strains fulfilling the important technological and probiotic criteria ability to grow in milk, acceptable antibiotic susceptibility profile and good in vitro tolerance to gastrointestinal stress factors were Lactobacillus paracasei, L. casei 018k-3 and L. casei 010k.
Aderiye, B.I. and Laleye S.A. 2003.Relevance of fermented food products in southwest Nigeria. Plant Foods for Human Nutrition (Formerly Qualitas Plantarum), 58(2), pp. 1-16.
Anukam, K.C. and Reid, G. 2009.African Traditional Fermented Foods and Probiotics. Journal of Medicinal Food, 12(6), pp. 1177-1184.
Aralbayev, N.A., 2009.A comparative study of the chemical composition of camel, goat and cow's milk. Food technology and service. Almaty, pp.29-45.
Baird-Parker, T.C. 2000.Production of Microbiologically safe and stable foods. In Lund B. and Baird- Parker T.C.,(Eds.), The Microbiological Safety and Quality of Food. Springer Science & Business Media. Aspen Publishers, Inc. Gaithersburg, Maryland, pp. 3-16.
Besselink, M., van Santvoort, H., Buskens, E., Boermeester, M., van Goor, H., Timmerman, H., Nieuwenhuijs, V., Bollen, T., van Ramshorst, B., Witteman, B., Rosman, C., Ploeg, R., Brink, M., Schaapherder, A., Dejong, C., Wahab, P., van Laarhoven, C., van der Harst, E., van Eijck, C., Cuesta, M., Akkermans, L. and Gooszen, H. 2008. Probiotic prophylaxis in predicted severe acute pancreatitis: a randomised, double-blind, placebo-controlled trial. The Lancet, 371(9613), pp.651- 659.
Carroll, L.M., Ringel-Kulka, T., and Ringel Y. 2010.Quantification and Identification of Probiotic Organisms in Humans.InFloch M.H. and Kim A.S., (Eds.).Probiotics A Clinical Guide. SLACK Inc.;
Thorofare, New York, pp.55-66.
Caumette, P. and Robert, M. 2015. Structure and Functions of Microorganisms: Production and Use of Material and Energy.In Bertrand, J., Caumette, P.,Lebaron, P.,Matheron, R., Normand, P., Sime- Ngando, T. (Eds.).Environmental Microbiology: Fundamentals and Applications:Microbial Ecology, Springer Netherlands, New York. pp. 25-71.
Cherepanova,A. Khacenov, A., Duisenbaev, Zh. and Belokobilenko, V. 1971.Kymyz and shubat.
Publishing selkhozgiz. Moscow, pp. 25-40.
Chikne, V.V. and Chiplunkar, S., 2014.Role of probiotic. In Nair B. and Takeda Y., (Eds). ECAB Health Impact of Probiotics: Vision & Opportunities. Elsevier Health Sciences. Haryana, pp.124- 149.
Cho, S. and Finocchiaro, T.E. 2010. Natural resistant starches as probiotics and synbiotics. In Cho S.S. and Finocchiaro T., (Eds.). Handbook of Prebiotics and Probiotics Ingredients: Health Benefits and Food Applications. FL: CRC Press. Boca Raton. New York, pp.123-138.
Danielsen, M. and Wind, A. 2003.Susceptibility of Lactobacillus spp. to antimicrobial agents.
International Journal Food Microbiology, 82 (1), pp. 1-11.
Davati, N., Tabatabaee, Y.F., Zibaee, S., Shahidi, F. and Edalatian, M.R., 2015. Study of Lactic Acid Bacteria Community From Raw Milk of Iranian One Humped Camel and Evaluation of Their Probiotic Properties. Jundishapur Journal of Microbiology, 8(5), pp.167.
Dodd, H.M. and Gasson, M.J. 1994. Bacteriocins of lactic acid bacteria. In Gasson M.J. and de Vos, W.,(Eds.). Genetics and Biotechnology of Lactic Acid Bacteria. Chapman & Hall, London, pp. 211- 245.
